BETTER TOGETHER: A JOINED-UP PSYCHOLOGICAL APPROACH TO HEALTH, WELL-BEING, AND REHABILITATION EDITED BY : Dónal G. Fortune, Elaine L. Kinsella and Orla M. Muldoon PUBLISHED IN : Frontiers in Psychology 1 August 2016 | Better T ogether: A Joined-Up Approach to Health Frontiers in Psychology Frontiers Copyright Statement © Copyright 2007-2016 Frontiers Media SA. All rights reserved. All content included on this site, such as text, graphics, logos, button icons, images, video/audio clips, downloads, data compilations and software, is the property of or is licensed to Frontiers Media SA (“Frontiers”) or its licensees and/or subcontractors. The copyright in the text of individual articles is the property of their respective authors, subject to a license granted to Frontiers. The compilation of articles constituting this e-book, wherever published, as well as the compilation of all other content on this site, is the exclusive property of Frontiers. For the conditions for downloading and copying of e-books from Frontiers’ website, please see the Terms for Website Use. If purchasing Frontiers e-books from other websites or sources, the conditions of the website concerned apply. Images and graphics not forming part of user-contributed materials may not be downloaded or copied without permission. Individual articles may be downloaded and reproduced in accordance with the principles of the CC-BY licence subject to any copyright or other notices. They may not be re-sold as an e-book. As author or other contributor you grant a CC-BY licence to others to reproduce your articles, including any graphics and third-party materials supplied by you, in accordance with the Conditions for Website Use and subject to any copyright notices which you include in connection with your articles and materials. All copyright, and all rights therein, are protected by national and international copyright laws. The above represents a summary only. For the full conditions see the Conditions for Authors and the Conditions for Website Use. ISSN 1664-8714 ISBN 978-2-88919-941-9 DOI 10.3389/978-2-88919-941-9 About Frontiers Frontiers is more than just an open-access publisher of scholarly articles: it is a pioneering approach to the world of academia, radically improving the way scholarly research is managed. The grand vision of Frontiers is a world where all people have an equal opportunity to seek, share and generate knowledge. Frontiers provides immediate and permanent online open access to all its publications, but this alone is not enough to realize our grand goals. Frontiers Journal Series The Frontiers Journal Series is a multi-tier and interdisciplinary set of open-access, online journals, promising a paradigm shift from the current review, selection and dissemination processes in academic publishing. All Frontiers journals are driven by researchers for researchers; therefore, they constitute a service to the scholarly community. At the same time, the Frontiers Journal Series operates on a revolutionary invention, the tiered publishing system, initially addressing specific communities of scholars, and gradually climbing up to broader public understanding, thus serving the interests of the lay society, too. Dedication to Quality Each Frontiers article is a landmark of the highest quality, thanks to genuinely collaborative interactions between authors and review editors, who include some of the world’s best academicians. Research must be certified by peers before entering a stream of knowledge that may eventually reach the public - and shape society; therefore, Frontiers only applies the most rigorous and unbiased reviews. Frontiers revolutionizes research publishing by freely delivering the most outstanding research, evaluated with no bias from both the academic and social point of view. By applying the most advanced information technologies, Frontiers is catapulting scholarly publishing into a new generation. What are Frontiers Research Topics? Frontiers Research Topics are very popular trademarks of the Frontiers Journals Series: they are collections of at least ten articles, all centered on a particular subject. With their unique mix of varied contributions from Original Research to Review Articles, Frontiers Research Topics unify the most influential researchers, the latest key findings and historical advances in a hot research area! Find out more on how to host your own Frontiers Research Topic or contribute to one as an author by contacting the Frontiers Editorial Office: researchtopics@frontiersin.org 2 August 2016 | Better T ogether: A Joined-Up Approach to Health Frontiers in Psychology BETTER TOGETHER: A JOINED-UP PSYCHOLOGICAL APPROACH TO HEALTH, WELL-BEING, AND REHABILITATION Topic Editors: Dónal G. Fortune, University of Limerick, Ireland Elaine L. Kinsella, University of Limerick, Ireland Orla M. Muldoon, University of Limerick, Ireland Health and well-being is best understood in terms of a combination of biological, psychological, and social factors. But how ‘social’ is the biopsychosocial model when applied to mental health and rehabilitation? Psychology has traditionally viewed health as being determined by individual behavior. An integrative psychological approach is required to draw understanding from sociol- ogy, social psychology, and politics to consider how wider systemic, structural, and contextual factors impact on health behavior and outcomes. This e-book is dedicated to examining collective and community approaches to well-being and rehabilitation. In particular, the articles contained within this e-book are seeking to understand how social integration, social groups, social identity, and social capital influence health, well-being, and rehabilitation outcomes. Citation: Fortune, D. G., Kinsella, E. L., Muldoon, O. M., eds. (2016). Better Together: A Joined-Up Psychological Approach to Health, Well-Being, and Rehabilitation. Lausanne: Frontiers Media. doi: 10.3389/978-2-88919-941-9 3 August 2016 | Better T ogether: A Joined-Up Approach to Health Frontiers in Psychology Table of Contents 05 Editorial: Better Together: A Joined-Up Psychological Approach to Health, Well-Being, and Rehabilitation Dónal G. Fortune, Elaine L. Kinsella and Orla M. Muldoon Section 1: Limitations of unitary biomedical explanations 08 The moderating role of an oxytocin receptor gene polymorphism in the relation between unsupportive social interactions and coping profiles: implications for depression Opal A. McInnis, Robyn J. McQuaid, Kimberly Matheson and Hymie Anisman 17 Mental health problems in adolescents with cochlear implants: peer problems persist after controlling for additional handicaps Maria Huber, Thorsten Burger, Angelika Illg, Silke Kunze, Alexandros Giourgas, Ludwig Braun, Stefanie Kröger, Andreas Nickisch, Gerhard Rasp, Andreas Becker and Annerose Keilmann 30 Schooling Relates to Mental Health Problems in Adolescents with Cochlear Implants—Mediation by Hearing and Family Variables Maria Huber, Belinda Pletzer, Alexandros Giourgas, Andreas Nickisch, Silke Kunze and Angelika Illg Section 2: Identification and Health 42 The Florence Nightingale Effect: Organizational Identification Explains the Peculiar Link Between Others’ Suffering and Workplace Functioning in the Homelessness Sector Laura J. Ferris, Jolanda Jetten, Melissa Johnstone, Elise Girdham, Cameron Parsell and Zoe C. Walter 57 Social and relational identification as determinants of care workers’ motivation and well-being Kirstien Bjerregaard, S. Alexander Haslam, Thomas Morton and Michelle K. Ryan 71 Family identification: a beneficial process for young adults who grow up in homes affected by parental intimate partner violence Catherine M. Naughton, Aisling T. O’Donnell and Orla T. Muldoon 80 Practicing What We Preach: Investigating the Role of Social Support in Sport Psychologists’ Well-Being Hannah M. McCormack, Tadhg E. MacIntyre, Deirdre O’Shea, Mark J. Campbell and Eric R. Igou 92 An integrative review of social and occupational factors influencing health and wellbeing MaryBeth Gallagher, Orla T. Muldoon and Judith Pettigrew 4 August 2016 | Better T ogether: A Joined-Up Approach to Health Frontiers in Psychology 103 Social Identities as Pathways into and out of Addiction Genevieve A. Dingle, Tegan Cruwys and Daniel Frings Section 3: Social identities and health outcomes 115 Discrimination and well-being amongst the homeless: the role of multiple group membership Melissa Johnstone, Jolanda Jetten, Genevieve A. Dingle, Cameron Parsell and Zoe C. Walter 124 Understanding help-seeking amongst university students: the role of group identity, stigma, and exposure to suicide and help-seeking Michelle Kearns, Orla T. Muldoon, Rachel M. Msetfi and Paul W. G. Surgenor 132 The impact of anticipated stigma on psychological and physical health problems in the unemployed group Aisling T. O’Donnell, Fiona Corrigan and Stephen Gallagher Section 4: Social themes associated with Acquired Brain Injury (ABI) 140 Changes in aspects of social functioning depend upon prior changes in neurodisability in people with acquired brain injury undergoing post-acute neurorehabilitation Dónal G. Fortune, R. Stephen Walsh, Brian Waldron, Caroline McGrath, Maurice Harte, Sarah Casey and Brian McClean 149 Post-traumatic growth following acquired brain injury: a systematic review and meta-analysis Jenny J. Grace, Elaine L. Kinsella, Orla T. Muldoon and Dónal G. Fortune Section 5: Commentary on psychosocial screening and assessment in oncology and palliative care settings 165 Commentary: Psychosocial screening and assessment in oncology and palliative care settings Kathrine G. Nissen EDITORIAL published: 28 June 2016 doi: 10.3389/fpsyg.2016.00974 Frontiers in Psychology | www.frontiersin.org June 2016 | Volume 7 | Article 974 | Edited and reviewed by: Gianluca Castelnuovo, Università Cattolica del Sacro Cuore, Italy *Correspondence: Donal G. Fortune donal.fortune@ul.ie Specialty section: This article was submitted to Psychology for Clinical Settings, a section of the journal Frontiers in Psychology Received: 19 April 2016 Accepted: 13 June 2016 Published: 28 June 2016 Citation: Fortune DG, Kinsella EL and Muldoon OM (2016) Editorial: Better Together: A Joined-Up Psychological Approach to Health, Well-Being, and Rehabilitation. Front. Psychol. 7:974. doi: 10.3389/fpsyg.2016.00974 Editorial: Better Together: A Joined-Up Psychological Approach to Health, Well-Being, and Rehabilitation Donal G. Fortune 1 *, Elaine L. Kinsella 2 and Orla M. Muldoon 3 1 Psychology, University of Limerick, Limerick, Ireland, 2 Psychology, Centre for Social Issues Research, Mary Immaculate College, University of Limerick, Limerick, Ireland, 3 Psychology, Centre for Social Issues Research, University of Limerick, Limerick, Ireland Keywords: health, well-being, rehabilitation, social support, social identity The Editorial on the Research Topic Editorial: Better Together: A Joined-Up Psychological Approach to Health, Well-Being, and Rehabilitation It is exactly 30 years since Arthur Kleinman introduced the term “sociosomatic” in an attempt to refocus attention in the health and psychological sciences on the often apparent, yet all too frequently neglected, social aspects of illness, disorder, and well-being (Kleinman, 1986). Social and cultural causes, social mediators, and moderators, and social outcomes were suggested by Kleinman as representing an additionally helpful, legitimate, and clinically useful formulation of disorder and well-being. This framework contextualized such multifaceted intra- and inter-personal challenges within the social, cultural, and material contexts of peoples’ everyday lives. Accordingly, the study of disorder and well-being necessarily requires the interdigitation of the person, their body, and their social and cultural world as essential and inter-dependent components of a comprehensive system of experience. Since Kleinman’s call to arms, one might be forgiven for perceiving psychology to have become increasingly fractionated and divided from its common or shared base. Certainly, it can be observed that professional psychology has developed into increasingly specialized and more numerous “Divisions,” further “dividing” or separating relevant and complementary knowledge bases that are likely to have increasing relevance in furthering our understanding of significant social issues. The need for such conceptual and applied integration across specialisms remains compelling, particularly in the case of health and well-being—which is the principal focus of this Frontiers Research Topic. In the initial call for papers for this Research Topic, we stated that health and well-being are best understood in terms of a combination of biological, psychological, and social factors; yet most formulations in this area remain constructed at the individual level. Indeed, it is over 10 years since Suls and Rothman observed that of all the published articles in the American Psychological Association’s journal Health Psychology, 94% assessed psychological variables only, with minimal attention given to broader socio cultural factors (Suls and Rothman, 2004). Thus, while the biopsychosocial model is the basic explanatory approach for understanding the whole person in health and illness, the social side of the approach remains underspecified and poorly integrated. Therefore, our principal aim as editors of this Research Topic was to encourage contributions that would permit readers to examine how social integration, social groups, social identity, and 5 Fortune et al. Better Together: A joined-Up Approach to Health social capital influence health and well-being across a variety of outcomes and in a broad number of populations. This over-arching aim was necessarily multidisciplinary and multi- paradigmatic, and assumed equality within the contribution according to the various levels of research focus (i.e., genes, clinical services, families, peer groups, organizational groups, and so forth) across the life span. The aim was, therefore, to attempt to cross the conceptual borders between such arbitrary divisions. As editors we attempted the challenging task of attracting and developing articles that would “stand-alone” as independent and significant contributions to the research literature, and that would also be consistent with the orientation and aims of this Research Topic, and with their companion articles. To this end, there was a clear need to bring together interdisciplinary research that utilized a range of approaches across a number of different populations in order to better elucidate common and unique factors relevant to social integration, social groups, social identity, and social capital within an applied framework. We were particularly fortunate to receive such a high standard of contribution in the form of 15 published articles. A number of original research articles in this Research Topic include some of the more novel approaches or areas of investigation that have been informed by significant developments in social, clinical, biological, health, and occupational psychology. Other articles in this Research Topic are concerned with the application of psychological models to vulnerable populations that have been largely underrepresented in research in this area. Given that the various aspects addressed in this Research Topic interrelate in a dynamic and contingent manner, the research presented reflects a necessarily eclectic orientation and supports a breadth of social, cognitive, and physiological viewpoints across the life span. Among the original research articles, two focussed on the limitations of unitary biomedical explanations. McInnis et al. reported that younger people who carry the oxytocin receptor gene polymorphism were more likely to engage in unhelpful coping styles to deal with negative social interactions, with resultant effects on mood. However, social support from parents and peers were fundamental in determining both coping and well-being regardless of genotype. Huber et al. reported that adolescents with cochlear implants who had additional disabilities did not significantly differ in terms of their relationships with school peers when compared with adolescents with no additional disabilities. Moreover, in an additional study, students in special schools for hearing impaired persons had more conduct problems than mainstream hearing-impaired children. This difference was partially explained by such children having greater difficulties in understanding speech in noisy backgrounds, coming from lower SES backgrounds, and single parent families (Huber et al.). No variable alone could explain comprehensively, why students in special schools have more mental health problems than mainstream pupils, however, the results reiterate the role of the social environment on mental health. Four articles in this Research Topic assessed the relationships between identification (with an organization) and health behaviors or outcomes. Stronger social identification with an employing organization mediated the relationship between recognizing suffering of clients and burnout in carer’s working with homeless adults (Ferris et al.). Moreover, Bjerregaard et al. reported that residential and community carers of older people reported more motivation when their relational identity with clients was perceived by them to be congruent with their organizational identity. Another article reported that although exposure to parental violence in the home reduces family identification generally, stronger identification with their extended family tended to be associated with lower anxiety and better self-esteem in younger people who witnessed parental violence within the home (Naughton et al.). Similarly, in a study examining burnout in sports psychologists across five countries, burnout was frequently experienced despite high levels of work engagement reported (McCormack et al.). The authors cite previous literature suggesting that high levels of work engagement and passion may buffer some of the negative effects of burnout, and in their own study report that social support appeared to facilitate recovery from burnout. Overall, our social situatedness informs our identity and our occupations in ways that directly influence our health and wellbeing (Gallagher et al.). On the topic of identity pathways, Dingle et al. reported that, contrary to the predominant viewpoint on redemptive narratives in addiction recovery, there are other identity-related pathways leading into and out of addiction in people in recovery, specifically an identity loss and an identity gain pathway which have implications for engagement with recovery models. The authors found that socially-isolated individuals benefitted from the creation of a new valued social identity through affiliation with a therapeutic community. These findings bring attention to the idea that social factors can act as motivations for and barriers to recovery during the course of addiction. Another theme contained within this Research Topic, concerns the importance of discriminated or discredited social identities and health outcomes. In a longitudinal study, Johnstone et al. reported that homeless people who perceived themselves to be discriminated against on the basis of their social group membership had fewer additional social group memberships at follow-up which consequently impacted their well-being (Johnstone et al.). and Kearns et al. reports that the stigma of accessing help for mental health services can mean those who identify with their organization, in this case a University, feel less able to access the services. In another article, unemployed people reported high levels of anticipated stigma which was associated with higher levels of psychological distress and increased report of physical ill-health (O’Donnell et al.). Two articles considered social themes associated with another vulnerable population, individuals with acquired brain injury (ABI). In an interventional study with people affected by ABI, Fortune et al. found that changes in more distal social integration outcomes following rehabilitation depend upon prior attainment of positive neurodisability (i.e., physical) outcomes. Further, the authors highlight that the usual time frames used in ABI studies as follow-up may be insufficient to capture important aspects of social integration or community participation. Adopting a salutogenic perspective, Grace et al.’s meta-analysis suggested that people with ABI can experience positive identity growth, and that community and collective factors are likely to enhance posttraumatic growth experiences. Frontiers in Psychology | www.frontiersin.org June 2016 | Volume 7 | Article 974 | 6 Fortune et al. Better Together: A joined-Up Approach to Health By focusing on cutting-edge research in social, clinical, biological, health, and occupational psychology, this Frontiers Research Topic allows new insights into how social integration, social support, and social identification influence health and well-being across a variety of outcomes and in a variety of populations—demonstrating that we are indeed better together. Beyond the excellent contributions that make up this Research Topic, we believe that this special focus will also give readers ideas for future research in this field, we hope, will continue to turn toward the investigation of social context in understanding wellbeing, illness, and disorder. AUTHOR CONTRIBUTIONS DF: Draft outline of Editorial, planned structure and added some content. EK: Fleshed out content and summarized research articles contained within Research Topic. OM: Proofed and made minor typo amendments. FUNDING This work was funded by the Irish Research Council New Foundations Award 2014. REFERENCES Kleinman, A. (1986). Social Origins of Distress and Disease . New Haven, CT: Yale University Press. Suls, J., and Rothman, R. A. (2004). Evolution of the biopsychosocial model: prospects and challenges for health psychology. Health Psychol. 23, 119–125. doi: 10.1037/0278-6133.23.2.119 Conflict of Interest Statement: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Copyright © 2016 Fortune, Kinsella and Muldoon. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Frontiers in Psychology | www.frontiersin.org June 2016 | Volume 7 | Article 974 | 7 ORIGINAL RESEARCH published: 11 August 2015 doi: 10.3389/fpsyg.2015.01133 Edited by: Orla T. Muldoon, University of Limerick, Ireland Reviewed by: Michelle Dow Keawphalouk, Harvard University – Massachusetts Institute of Technology, USA Roger Christopher McIntosh, University of Miami, USA *Correspondence: Opal A. McInnis, Department of Neuroscience, Carleton University, 1125 Colonel By Drive, Ottawa, ON K1S 5B6, Canada opal_mcinnis@carleton.ca Specialty section: This article was submitted to Psychology for Clinical Settings, a section of the journal Frontiers in Psychology Received: 04 April 2015 Accepted: 20 July 2015 Published: 11 August 2015 Citation: McInnis OA, McQuaid RJ, Matheson K and Anisman H (2015) The moderating role of an oxytocin receptor gene polymorphism in the relation between unsupportive social interactions and coping profiles: implications for depression. Front. Psychol. 6:1133. doi: 10.3389/fpsyg.2015.01133 The moderating role of an oxytocin receptor gene polymorphism in the relation between unsupportive social interactions and coping profiles: implications for depression Opal A. McInnis 1 * , Robyn J. McQuaid 1 , Kimberly Matheson 2 and Hymie Anisman 1 1 Department of Neuroscience, Carleton University, Ottawa, ON, Canada, 2 Department of Health Sciences, Carleton University, Ottawa, ON, Canada Oxytocin is a hormone that is thought to influence prosocial behaviors and may be important in modulating responses to both positive and negative social interactions. Indeed, a single nucleotide polymorphism, rs53576, of the oxytocin receptor gene (OXTR) has been associated with decreased trust, empathy, optimism, and social support seeking, which are important components of coping with stressors. In the current study, conducted among undergraduate students ( N = 225), it was shown that parental and peer social support was related to fewer depressive symptoms through elevated problem-focused coping and lower emotion-focused coping, and these effects were independent of the OXTR polymorphism. Unsupportive social interactions from parents were associated with more severe depressive symptoms through the greater use of emotion-focused coping, and this relation was moderated by the OXTR genotype. Specifically, individuals who carried the polymorphism on one or both of their alleles demonstrated increased emotion-focused coping following unsupportive responses compared to those without the polymorphism. Likewise, lower problem-focused coping mediated the relation between parental and peer unsupportive responses to depressive symptoms, but this mediated relation was only evident among carriers of the polymorphism. These findings suggest that carrying this OXTR polymorphism might favor disadvantageous coping styles in the face of negative social interactions, which in turn are linked to poor mood. Regardless of genotype, parental, and peer social support are fundamental in determining stress-related coping and well-being. Keywords: depression, polymorphism, oxytocin, social support, coping, social interaction Introduction Supportive relationships and social connectedness are important predictors of health and well- being that serve as a buffer against several negative consequences of stressors (Cohen and Wills, 1985; Thoits, 2011). In contrast, a lack of social support has been associated with increased risk of chronic health conditions, such as heart disease and diabetes (House et al., 1988; Holt-Lunstad et al., 2010). Thus, enhancing social connectedness and social identity may attenuate depressive Frontiers in Psychology | www.frontiersin.org August 2015 | Volume 6 | Article 1133 | 8 McInnis et al. Oxytocin polymorphism, unsupport, and coping symptomatology (Cruwys et al., 2014, 2015). The experience of unsupportive social relationships, comprise negative, or ineffective social interactions, when help or advice is sought during a challenging or stressful time (Ingram et al., 1999, 2001). These unsupportive responses from others include the minimization of problems, blaming the individual, distancing themselves from an individual and their problems, and bumbling attempts to provide support. Importantly, the experience of unsupportive social interactions predicts depressive symptoms above and beyond the contribution of social support (Ingram et al., 1999; Song and Ingram, 2002). Despite the established beneficial effects of social support and the profound impact of unsupportive social interactions on well-being, the biological mechanisms underlying their influence remain largely unknown and under-investigated. Oxytocin is a hormone that may contribute to a constellation of social behaviors, ranging from trust (Kosfeld et al., 2005) and attachment (Buchheim et al., 2009) to positive communication (Ditzen et al., 2009) and intergroup cooperation (De Dreu et al., 2010). The involvement of oxytocin in these prosocial behaviors in humans has been demonstrated following its administration through a nasal spray (Bakermans-Kranenburg and van IJzendoorn, 2013). As well, support for the involvement of oxytocin in mediating social behavior has come from genetic studies. Specifically, variations in the gene coding for the oxytocin receptor OXTR, in which a single nucleotide polymorphism (SNP) rs53576, which involves a guanine (G) to adenine (A) substitution, has been associated with diminished prosocial behaviors (Kumsta and Heinrichs, 2013). In this regard, compared to individuals who were homozygous for the G allele (i.e., the SNP was not present), A carriers tended to be less empathetic (Rodrigues et al., 2009), displayed lower parental sensitivity (Bakermans-Kranenburg and van IJzendoorn, 2008), and lower trust-related behaviors (Krueger et al., 2012). This SNP has also been associated with lower positive affect (Lucht et al., 2009), and self-esteem as well as greater depressive symptoms (Saphire-Bernstein et al., 2011). In effect, individuals who carry this SNP on one or both alleles (AG or AA genotype) appear to be less socially inclined and potentially at a greater risk for mental health disturbances. Although coping strategies are not intrinsically negative or positive, depression is frequently associated with the endorsement of lower levels of problem-focused coping and higher levels of emotion-focused coping (Matheson and Anisman, 2003). For instance, depressive disorders have been tied to greater levels of rumination (Aldao et al., 2010) and emotional containment (Ravindran et al., 2002), as well as decreased social support seeking (Matheson and Anisman, 2003) and reduced use of cognitive restructuring (Ravindran et al., 2002). Given that A carriers are less apt to use social support as a means of coping, and benefit less from this coping method, it is possible that the presence of the OXTR SNP might favor the adoption of a relatively narrow range of effective coping strategies (i.e., those that do not rely on social support resources). As a result,the A allele might be associated with greater vulnerabilty to the negative impacts of stressors relative to those with the G allele. There have been several reports, however, that do not comfortably align with the perspective that the A allele of the OXTR rs53576 gene is associated with vulnerability to disturbed social and emotional functioning. Indeed, the G allele of the OXTR was associated with greater social sensitivity (Bradley et al., 2011; McQuaid et al., 2013; Hostinar et al., 2014), which in the context of negative early life experiences, may be accompanied by greater emotional dysregulation (Bradley et al., 2011) and elevated depressive symptoms among adults (McQuaid et al., 2013). As well, maltreated adolescents who were homozygous for the G allele were more likely to perceive lower social support and reported greater internalizing of symptoms compared to maltreated A allele carriers (Hostinar et al., 2014). The social sensitivity perspective is in line with the suggestion that certain genetic variants may promote behavioral and emotional plasticity, so that environmental and experiential factors, irrespective of whether they are positive or negative, have greater effects on later outcomes (Belsky and Pluess, 2009; Belsky et al., 2009). In essence, the presence of the GG alleles might be accompanied by elevated sensitivity to social cues, irrespective of whether these involved a positive and nurturing early life environment or one that was more negative, and as a result influence social inclinations and mood in adulthood (Bradley et al., 2011; McQuaid et al., 2013; Hostinar et al., 2014). The elevated sensitivity to environmental factors and the heightened neuroplasticity associated with increased oxytocin functioning (Lin et al., 2012) and with the G allele, could promote the adoption or development of social coping methods (McQuaid et al., 2014a). Indeed, within a stable or warm family environment, G carriers reported greater positive affect and ‘resilient’ coping, an association that was not observed among those with the AA genotype (Bradley et al., 2013). Conversely, those with the AA genotype sought less emotional social support during distress compared to G carriers (Kim et al., 2010), and also appeared to be less able to benefit from social support (Chen et al., 2011). Among adolescents who carried an A allele, but not among GG homozygotes, experiences of maternal depression predicted lower social functioning, which, in turn, was associated with elevated depressive symptoms (Thompson et al., 2014). Although unsupportive relationships can have profound effects on mood states, it is uncertain whether the effects of such relationships vary as a function of oxytocin levels or the presence of the OXTR polymorphism. As well, coping methods (e.g., emotion-, avoidant-, and problem-focused coping) which are also important predictors of well-being have not been investigated in association with the genetic variants of the OXTR. In the present investigation we assessed experiences of social support and unsupport from both parents and peers in relation to depressive symptoms and whether these relations were mediated by coping styles. It was of particular interest to determine whether the OXTR rs53576 genotype moderated these mediated relationships. It is possible that the greater social sensitivity of those with the GG genotype would be accompanied by emotion-focused coping in response to unsupportive social interactions, and more effective coping skills in the presence of social support. In contrast, A carriers, who tend to have a more negative affect (and may be less sensitive to social interactions), Frontiers in Psychology | www.frontiersin.org August 2015 | Volume 6 | Article 1133 | 9 McInnis et al. Oxytocin polymorphism, unsupport, and coping might be more likely to adopt disadavantageous coping methods that involve emotion- more than problem-focused coping styles, irrespective of perceiving support, or experiencing unsupportive interactions. Materials and Methods Participants Participants included 232 White/Euro-Caucasian female ( n = 189) and male ( n = 43) undergraduate students. Participants were recruited through a university online-recruitment system as well as through campus advertisements. Ages ranged between 17 and 35 years of age ( M = 19.75, SD = 2.78). Current living arrangements varied, with the majority of participants living with either friends/roommates (52.16%), or with parents (31.47%), and the remaining participants reporting living alone (5.60%), with a significant other (4.74%), or other arrangements (6.03%; e.g., living with children). Procedure Following the provision of informed consent, participants were provided with a series of questionnaires that assessed demographic information, current symptoms of depression, coping styles, as well as levels of perceived support and unsupportive interactions from parents and peers. Following completion of questionnaires, a single saliva sample was collected from participants for DNA analyses. All participants were provided with a written debriefing explaining the purpose and objectives of the study, as well as researcher contact information. All procedures for the present study were approved by the Carleton University Ethics Committee for Psychological Research. Genotyping Saliva samples for DNA analyses were collected using an Oragene OG-500 saliva sample collection kit purchased from DNA Genotek (Ottawa, ON, Canada). Manufacturer’s instructions were followed for the extraction of genomic DNA and following extraction samples were diluted to approximately equal concentrations (20 ng/ μ L). DNA samples were genotyped using quantitative polymerase chain reaction (qPCR). The amplification reactions were performed using approximately 1 μ L (20 ng) of genomic template, 0.6 μ L of each primer (with a concentration of 10 μ M), 1.2 μ L of dNTP, 1.5 μ L of 10X buffer, 1.5 μ L of MgCl 2 , 0.3 μ L of Salmon Sperm DNA, 0.15 μ L of Taq polymerase, 0.015 of SYBR green, 8.135 μ L of water. The total volume of the resulting solution was 15 μ L. Solutions were plated in duplicate and qPCR products were run on 2% agarose gel electrophoresis to visualize and confirm qPCR results. The primer sequences used for qPCR were the following: OXTR F1 forward: TCCCTGTTTCTGTGGGACTGAGGAC OXTR F2 forward: TCCCTGTTTCTGTGGGACTGAGGAT OXTR reverse: TCCCTGTTTCTGTGGGACTGAGGAT Allele distribution for the OXTR polymorphism comprised 104 individuals with the homozygote GG genotype, (87 female, 17 male), 89 individuals with the heterozygote AG genotype (71 female, 18 male), and 32 individuals with the homozygote AA genotype (25 female, 7 male). Genotype distributions did not differ as a function of gender χ 2 ( 1 ) = 0.73, p = 0.70. Additionally, genotype distributions for males, χ 2 ( 1 ) = 0.35, p = 0.55, and females, χ 2 ( 1 ) = 2.79, p = 0.09, met Hardy– Weinberg Equilibrium expectations. The initial sample size was 232 but there were seven individuals for whom the genotype could not be determined and hence they were excluded from any subsequent analyses making the overall N = 225. Further, due to the infrequency of the AA genotype, a dominant model was used wherein all A carriers (AA and AG were pooled) were compared to individuals with the GG genotype. Measures Depressive Symptoms Depressive symptoms were assessed using the Beck Depression Inventory (BDI; Beck et al., 1961). This is a 21-item questionnaire in which participants respond to each item by selecting one of four options that range from low to high depression symptomology. The scores were calculated as the total sum across all items (Cronbach’s α = 0.90). Unsupportive Social Interactions Levels of unsupportive social interactions from parents and peers were assessed using the Unsupportive Social Interactions Inventory (USII; Ingram et al., 2001). This 24-item scale was administered twice (once for parents, and once for peers) and assessed the degree of perceived unsupport individuals received from their parents or peers when turning to them during a recent stressful or challenging time. Participants responded to each item ranging from none (0) to a lot (4). The unsupport scale comprised four subscales that included distancing (behavioral or emotional disengagement; e.g., “Would not seem to want to hear about it”), bumbling (behaviors that are awkward, or uncomfortable; e.g., “Would try to cheer me up when I was not ready to”), minimizing (attempts to minimize the individual’s concerns; e.g., “Would feel that I was overreacting”), and blaming (finding fault or criticism; e.g., “Would make “I told you so” or similar comments”). The four subscales were highly correlated with one another [ranging from r = 0.47 to 0.65 (Parents) and r = 0.42 to 0.58 (Peers)], and so total mean scores of unsupport were used (Peers: Cronbach’s α = 0.92; Parents: Cronbach’s α = 0.93). Social Support Perceived social support from parents and peers was assessed using the Social Provisions Scale (Cutrona and Russell, 1987). Participants were asked to respond to this shortened 12-item scale twice (once for parents, and once for peers) by rating the degree to which their parents or peers are currently providing them with different forms of support including, guidance, reassurance of worth, reliable alliance, social integration, opportunity to provide nurturance and attachment. This shortened version has been shown to demonstrate good construct validity (Russell et al., 1984). Total mean scores of social support were used and demonstrated good reliability (Peers: Cronbach’s α = 0.87; Parents: Cronbach’s α = 0.81). Frontiers in Psychology | www.frontiersin.org August 2015 | Volume 6 | Article 1133 | 10 McInnis et al. Oxytocin polymorphism, unsupport, and coping Coping Styles The Survey of Coping Profile Endorsement (Matheson and Anisman, 2003) is a 50-item scale that assesses the means individuals use to cope. Participants indicated on a scale of never (1) to almost always (5), the extent to which they would use t